[صفحه اصلی ]   [Archive] [ English ]  
:: صفحه اصلي :: درباره نشريه :: آخرين شماره :: آرشيو مقالات :: جستجو :: ثبت نام :: ارسال مقاله :: تماس با ما ::
:: جلد 13، شماره 3 - ( پاييز 1395 ) ::
جلد 13 شماره 3 صفحات 232-224 برگشت به فهرست نسخه ها
miR-146a : یک سرکوبگر احتمالی تومور در مالتیپل میلوما
شیما کاظم زاده، علیرضا فارسی نژاد، جاوید صبور تکانلو، سعید کاویانی، امیر آتشی، مسعود سلیمانی، سعید آبرون
تهران ـ ایران ـ صندوق پستی: 331-14115
واژه‌های کلیدی: کلمات کلیدی: مالتیپل میلوما، میکرو RNA ها، miR-146a انسانی
متن کامل [PDF 552 kb]   (1224 دریافت)     |   چکیده (HTML)  (5702 مشاهده)
نوع مطالعه: پژوهشي | موضوع مقاله: هماتولوژي
انتشار: 1395/6/17
متن کامل:   (1239 مشاهده)
 : یک سرکوبگر احتمالی تومور در مالتیپل میلوما
 
شیما کاظم‌زاده1، علیرضا فارسی‌نژاد2، جاوید صبور تکانلو1، سعید کاویانی3، امیر آتشی4،
مسعود سلیمانی5، سعید آبرون5
 
 
چکیده
سابقه و هدف
میکروRNAها با تنظیم بیان ژن در سطح پس از رونویسی، نقش کلیدی را در کنترل پاسخ­های ایمنی، التهاب، رشد و مرگ سلولی ایفا می­نمایند. بسیاری از میکروRNAها به عنوان انکوژن، سرکوبگر تومور و تعدیل‌کننده رشد سلول­های بنیادی سرطانی عمل می­نمایند. miR-146a ، از میکروRNAهایی است که نقش مهمی در بروز سرطان­ها ایفا نموده و می­تواند به عنوان محرک رشد و یا سرکوبگر تومور عمل کند. مطالعه حاضر به­ منظور ارزیابی تغییرات بیان miR-146a در رده­های سلولی میلومایی(L363 ، LP1 ،8226  RPMI و KMM1) در مقایسه با لکوسیت­های طبیعی انجام گرفت.
مواد و روش‌ها
در مطالعه تجربی حاضر، چهار رده سلولی میلومایی و لکوسیت­های طبیعی جدا شده از خون محیطی فرد سالم در شرایطی معین کشت داده شد. پس از استخراجRNA  از سلول­ها، بیان miR-146a به صورت کمی با انجام RT-PCR اندازه‌گیری شد.
یافته‌ها
برطبق یافته­ها، بیان miR-146a در رده­های میلومایی نسبت به لکوسیت­های طبیعی به طور معنا­داری کاهش یافته است. آنالیز داده­ها نشان داد که در مقایسه با لکوسیت­های طبیعی، بیان miR-146a در رده سلولی L363 به طور میانگین 2/0 ± 32/0 برابر، در رده­های LP1 به طور میانگین 07/0 ± 03/0 برابر و در رده­های RPMI 8226 و KMM1 به ترتیب و به طور میانگین 02/0 ± 0035/0 و 001/0 ± 0022/0 برابر کاهش یافته است (01/0 p<).
نتیجه گیری
با توجه به یافته­­ها، به نظر می­رسد که miR-146a می­تواند به­ عنوان یک سرکوبگر تومور در لکوسیت­ها عمل نموده و کاهش بیان این میکرو RNA در سلول­های میلومایی به احتمال زیاد در پیدایش و یا پیشرفت مالتیپل میلوما مؤثر می­باشد.
کلمات کلیدی: مالتیپل میلوما، میکرو RNA ها، miR-146a انسانی
 
 
 
 
 
 
تاریخ دریافت : 14/10/94
تاریخ پذیرش :  12/3 /95
 

1- دانشجوی کارشناسی ارشد هماتولوژی و بانک خون ـ دانشکده پزشکی دانشگاه تربیت مدرس ـ تهران ـ ایران
2- PhD هماتولوژی و بانک خون ـ استادیار گروه هماتولوژی و علوم آزمایشگاهی ـ دانشگاه علوم پزشکی کرمان ـ کرمان ـ ایران
3- مؤلف مسئول: PhD هماتولوژی و بانک خون ـ دانشیار دانشکده پزشکی دانشگاه تربیت مدرس ـ تهران ـ ایران ـ صندوق پستی: 331-14115
4- PhD هماتولوژی و بانک خون ـ استادیار دانشکده پزشکی دانشگاه علوم پزشکی شاهرود ـ شاهرود ـ ایران
5- PhD هماتولوژی و بانک خون ـ دانشیار دانشکده پزشکی دانشگاه تربیت مدرس ـ تهران ـ ایران
 

مقدمه
    مالتیپل میلوما، نوعی بدخیمی­ است که با تکثیر کلونال پلاسما سل­ها در مغز استخوان و افزایش تولید ایمنوگلوبولین­های مونوکلونال مشخص می­گردد(1). ناهنجاری­های سیتوژنتیکی و مولکولی مختلف سبب بروز مالتیپل میلوما می­شوند(2). پس از لنفوما، مالتیپل میلوما دومین بدخیمی خونی شایع در جهان است(3). تلاش­های بسیاری در جهت افزایش بقای بیماران مبتلا به مالتیپل میلوما صورت گرفته است. پیشرفت­­های اخیر در علم بیولوژی سلولی و مولکولی با توسعه روش­های درمانی نوین در سرطان­ها همراه بوده است. در این روش­ها اختلالات ژنتیکی و اپی ژنتیکی در مسیرهای پیام­دهی، به ویژه مسیرهای مؤثر در پاتوژنز بدخیمی، به عنوان هدف‌های درمانی مورد استفاده قرار می­گیرند. شناسایی میکرو RNA ها و تعیین نقش آن‌ها در تنظیم بیان ژن، زمینه­ای مناسب در درک هر چه بیشتر بیولوژی سلول­های سرطانی و تعیین درجه بدخیمی آن­ها فراهم آورده است(4). الگوهای بیان میکرو RNA ها در چندین بدخیمی­ خونی هم چون لوسمی مزمن لنفوئیدی(CLL) و لوسمی حاد میلوئیدی(AML) تا حد زیادی مشخص شده است(8-5). به ­علاوه همبستگی چندین میکرو RNA با زیر گروه­های ژنتیکی لوسمی­های حاد و CLL تعیین گردیده است(11-9). این در حالی است که اطلاعات به ­دست آمده در این زمینه در مورد مالتیپل میلوما محدود می‌باشد (13، 12). مطالعه‌های اخیر مؤید نقش کلیدی میکرو RNAها در مالتیپل میلوما است، به گونه­ای که نه تنها در پیشرفت بدخیمی، بلکه در شروع آن، که به دنبال متیلاسیون میکرو RNA های مهارکننده تومور است، مؤثر می­باشند(14).
    میکرو RNA ها گروهی از RNAهای تک رشته­ای کوتاه(23-20 نوکلئوتیدی) هستند که بیان ژن را کنترل می­نمایند. این RNAهای غیرکد کننده کوچک با شرکت در کمپلکس RISC (RNA-induced silencing complex)، سبب اتصال کمپلکس مذکور به نواحی مکمل در 3′ UTR در mRNA های هدف شده و با تخریب و یا مهار mRNA هدف، بیان ژن را در سطح پس از رونویسی (post-transcriptional)، کنترل می­نمایند. مطالعه‌های انجام شده بر نقش میکرو RNA ها در فرآیندهای مهم بیولوژیکی از جمله پاسخ­های ایمنی ذاتی و اکتسابی، التهاب، رشد و مرگ سلولی تاکید دارند(16، 15، 4). علاوه ­بر این، بسیاری از میکرو RNA ها به عنوان انکوژن، سرکوبگر تومور و حتی تعدیل کننده رشد سلول­های بنیادی سرطانی و متاستاز عمل می­نمایند(17).
    miR-146a از جمله میکرو RNA هایی است که نقش مهمی در بروز بیماری­های التهابی و سرطان­های گوناگون ایفا می­کند. miR-146 نخستین بار به عنوان یک تنظیم­گر سیستم ایمنی در پاسخ به عفونت­های میکروبی شناسایی گردید. بررسی­های بیشتر نشان داد که miR-146a/b در مسیر وابسته به NF-kB قرار داشته و توسط TLR القا می‌گردد. این میکرو RNA با هدف قرار دادن دو پروتئین ضروری در مسیر انتقال پیام پیش‌التهابی به نام­های TRAF6 (TNF receptor–associated factor 6) و IRAK1 (IL-1 receptor-associated kinase 1)، مسیر NF-Kb را مهار می‌نماید(18، 13). مطالعه‌های گسترده­ای در زمینه نقش miR-146a در پاتوژنز سرطان­های گوناگون صورت گرفته که جمع‌بندی نتایج این بررسی­ها نشان­دهنده نقش دوگانه miR-146a در سرطان­­ها است. به­ عبارت دیگر، بسته به ماهیت سلول­های بدخیم و مسیرهای انتقال پیام فعال شده کـه miR-146a در آن­هـا دخیـل اسـت، میکرو RNA مذکور نقش انکوژنی و یا مهارکنندگی تومور را ایفا می‌نماید(20، 19).
    با توجه به اهمیت میکرو RNA ها در بیولوژی سرطان، مطالعه حاضر به­منظور ارزیابی تغییرات بیان miR-146a به عنوان یکی از عوامل ژنتیکی کلیدی در شروع و پیشرفت بدخیمی، انجام گرفت. به همین منظور میزان بیان miR-146a در رده­های سلولی مرتبط با مالتیپل میلوما (L363 ، LP1 ، RPMI 8226 و KMM1) اندازه‌گیری و با لوکوسیت‌های طبیعی خون مقایسه گردید.
 
مواد و روش‌ها
کشت سلول:
  در مطالعه تجربی حاضر، چهار رده سلولی L363 ، LP1 ،
RPMI 8226 و KMM1 به­ عنوان گروه آزمایش و لکوسیت­های جدا شده از خون فرد سالم به­ عنوان گروه شاهد مورد استفاده قرار گرفت. از آن جا که رده­های سلولی میلومایی دارای ترانس لوکاسیون­ها و موتاسیون­های متعددی هستند، در این مطالعه، چهار رده سلولی میلومایی متفاوت(L363 ، LP1 ، RPMI 8226 و KMM1) مورد بررسی قرار گرفت تا امکان تعمیم نتایج به دست آمده وجود داشته باشد. تمامی رده‌های سلولی فوق‌الذکر در محیط کشت RPMI 1640 (آمریکا، جیبکو) حاوی 10% FBS (آمریکا، جیبکو) و 1% آنتی‌بیوتیک پنی‌سیلین- استرپتومایسین(آمریکا، جیبکو)، در دمای 37 درجه سانتی‌گراد با 95% رطوبت و 5% CO2 کشت داده شدند. زمانی­که سلول­ها به پاساژ دوم رسیدند، جهت استخراج RNA مورد استفاده قرار گرفتند.
 
جداسازی لکوسیت­ها از خون محیطی فرد سالم:
    برای این منظور مقدار 3 میلی‌لیتر خون حاوی ضد انعقاد EDTA  با 3 میلی‌لیتر PBS رقیق شد، سپس خون رقیق شده به آرامی بر روی 3 میلی‌لیتر فایکول قرار گرفت و با سرعت  g400 به مدت 30 دقیقه سانتریفوژ شد. سلول­های تک هسته­ای خون محیطی(PBMCs = Peripheral Blood Mononuclear Cells) که در حد فاصل فایکول و خون رقیق شده تجمع پیدا کرده بودند، به آرامی جمع‌آوری گردید. به منظور حذف فایکول،PBMC  جدا شده سه مرتبه با PBS شسته شده و رسوب سلولی در 100 میکرولیترPBS  به ­صورت سوسپانسیون در آمد. تعداد PBMC جداسازی شده با استفاده از لام نئوبار تعیین گردید.
 
استخراج Total RNA :
    به­ منظور تخلیص RNA سلولی، از کیت RNXTM –PLUS (ایران، سیناژن) که بر پایه اختلاف فاز فنل- کلروفرم عمل می­کند، استفاده شد. بر طبق دستورالعمل کیت مربوطه، RNA از چهار رده سلولی مورد آزمایش استخراج شده و رسوب RNA در 50-30 میکرولیتر آب DEPC (Diethylpyracarbonate) (و یا آب مقطر فاقد آنزیم
RNase و DNase) حل گردید.
    جهت ارزیابی کمی و تعیین غلظت RNA تخلیص شده، جذب نوری RNA در طول موج 260 نانومتر و با استفاده از اسپکتروفتومتر(Thermo Scientific NanoDrop TM ND-2000c) خوانده شد. به­ منظور تعیین درجه خلوص RNA تخلیص شده، جذب نوری 280/260 و 230/260 نانومتر نیز سنجیده شد. در مرحله بعد، جهت ارزیابی کیفیت RNA تخلیص شده، مقدار 1 میکرولیتر از RNA تخلیص شده بر روی ژل آگارز 2% الکتروفورز شد.
 
ساخت cDNA :
    ساخت cDNA با استفاده از کیت شرکت کیاژن (QuantiTect® Reverse Transcription kit, QIAGEN) و آغازگرهای Stem-loop اختصاصی برای miR-146a و SNORD-47 (به­ عنوان کنترل داخلی) و با انجام واکنش رونویسی معکوس(RT-PCR) انجام گرفت. توالی آغازگرهای Stem loop اختصاصی برای miR-146a به صورت:
GTCGTATGCAGAGCAGGGTCCGAGGTATTCGCACTGCATACGACAACCCAT
و برای SNORD-47 به صورت:
GTCGTATGCAGAGCAGGGTCCGAGGTATTCGCACTGCATACGACAACCTC بود. طبق دستورالعمل کیت مربوطه، مخلوط واکنش تهیه گردید و سپس واکنش رونویسی معکوس با برنامه دمایی زیر انجام گرفت:
    15 دقیقه در 25 درجه سانتی­گراد، 15 دقیقه در 37 درجه سانتی‌گراد، 60 دقیقه در 42 درجه سانتی‌گراد و 5 دقیقه در 70 درجه سانتی‌گراد. آغازگرهای استفاده شده در Real Time PCR از مرکز تحقیقات و فناوری بن‌یاخته تهیه شد.
 
Real Time PCR :
    به­ منظور ارزیابی کمی بیان miR-146a در نمونه­های آزمایش و کنترل، روش Real Time PCR با توجه به دستورالعمل کیت مربوطه انجام گرفت. بدین منظور، مخلوطی از SYBR® Green RT-PCR Master Mix (آمپلیکـون، دانمـارک)، آغازگرهـای جلـوبرنده اختصاصی
 

جدول 1: توالی آغازگرهای Real time PCR
 
  توالی آغازگر دمای اتصال (°C)
miR-146a F- 5'TCCGTGAGAACTGAATTCC-3' 60
SNORD-47 F-5'ATCACTGTAAAACCG TTCCA-3' 60
Common Reverse R-5'GAGCAGGGTCCGAGGT-3' 60
 
برای miR-146a )و یا SNORD-47) و آغازگر معکوس مشترک، رنگ ROX ، cDNA و آب فاقد آنزیم RNase بر روی یخ تهیه شده و پس از اسپین کوتاه، به دستگاه StepOne™ Real-Time PCR انتقال یافتند. واکنش RT-
PCR
با برنامه دمایی روبرو انجام گرفت: 15 دقیقه در 95 درجه سانتی‌گراد و سپس 40 سیکل شامل 30 ثانیه در 95 درجه سانتی‌گراد و 60 ثانیه در 60 درجه سانتی‌گراد(جدول 1). به منظور آنالیز داده­های به دست آمده از نرم‌افزار 18 SPSS و آزمون Paired-Samples t test استفاده شد.
 
یافته‌ها
ارزیابی بیان miR-146a در رده­های سلولی میلومایی و لکوسیت­های طبیعی:
    در مطالعه حاضر، تخلیص RNA از نمونه­های میلومایی (سلول­های چهار رده L363 ، LP1 ، RPMI و KMM1) و نمونه کنترل (لکوسیت­های طبیعی خون)، ساخت cDNA از RNAهای تخلیص شده و بررسی کمی بیان miR-146a با روش RT-PCR در شرایطی یکسان صورت گرفت.


نمودار 1 : نمودار بالا مربوط به منحنی تکثیر miR-146a در لکوسیت­های طبیعی خون است و نمودار پایین، منحنی تکثیر miR-146a در رده­های سلولی میلومایی را نشان می­دهد.

 

نمودار 2: نمودار سمت راست منحنی ذوب miR-146a در رده­های سلولی میلومایی(Tm: 79.17) و نمودار سمت چپ منحنی ذوب miR-146a در لکوسیت­های طبیعی خون (Tm: 78.54) را نشان می­دهد.
 

نمودار 3: ارزیابی کمی بیان miR-146a در رده­های سلولی میلومایی و لکوسیت­های نرمال با Real Time PCR
 
    منحنی تکثیر miR-146a در لکوسیت‌های طبیعی خون و سلول­های میلومایی و منحنی ذوب miR-146a در این سلول­ها در نمودار نشان داده شده است(نمودارهای 1 و 2).
    جهت آنالیز داده­های به دست آمده و سنجش نسبی بیان miR-146a ، از مدل 2- ΔΔCT استفاده شد. در این روش با فرض برابری راندمان تکثیر(Efficiency) بین ژن مورد نظر و ژن مرجع، مقایسه انجام می­شود.
   نتایج به دست آمده حاکی از آن است که بیان miR-146a     
در چهار رده سلولی میلومایی نسبت به لکوسیت­های طبیعی خون به طور قابل توجهی کاهش یافته است(نمودار 3). آنالیز داده­های RT-PCR نشان دهنده کاهش بیان معنادار miR-146a در رده سلولی L363 نسبت به لکوسیت­های طبیعی خون است(03/0 = p). در رده سلولی مذکور، کاهش بیان به طور میانگین 2/0 ± 32/0 برابر گزارش شد. در رده سلولی LP1 نیز کاهش بیان miR-146a معنا­دار بوده و به طور میانگین 07/0 ± 03/0 برابر است (002/0 p=). کاهش بیان معنا­دار miR-146a در رده‌های سلولی RPMI و KMM1 نسبت به لکوسیت­های طبیعی خون به ترتیب و به طور میانگین 02/0 ± 0035/0 و 001/0 ± 0022/0 برابر مشاهده شد(001/0 p =).
 
بحث
    یافته­های مطالعه حاضر کاهش بیان معنا­دار miR-146a را در سلول­های رده میلومایی نسبت به لکوسیت­های طبیعی خون نشان می­دهد. مطالعه‌ها حاکی از آن است که miR-146a نقشی مهم و کلیدی را در پاتوژنز سرطان­ها ایفا می­کند و از یک سو با تقویت پتانسیل تومورزایی به عنوان یک آنکوژن عمل کرده و از سوی دیگر با اثر بر قدرت تکثیر، تمایز و تهاجم سلول­ها، مانع از رشد تومور می‌گردد. نوع و ماهیت سلول­های بدخیم و هم چنین مسیرهای انتقال پیام فعال شده که miR-146a در آن­ها دخیل است، تعیین‌کننده تاثیر مثبت و یا منفی میکرو RNA  مذکور بر رشد سلول­های سرطانی است(20). با تکیه بر نتایج مطالعه حاضر، به نظر می­رسد که miR-146a به­ عنوان یک سرکوبگر تومور در لکوسیت­ها عمل می­کند. به ­عبارت دیگر، سلول­های میلومایی از طریق کاهش بیان miR-146a بر فعالیت سرکوبگر توموری میکرو RNA مذکور غلبه کرده و موجب پیشرفت بدخیمی می­گردند. مسأله مورد سؤال این است که کاهش بیان miR-146a در پلاسماسل­ها یک رویداد اولیه بوده و سبب شروع میلوما می­گردد و یا این­ که یک رویداد ثانویه است و در پیشرفت بدخیمی دخالت دارد. این موضوع لزوم بررسی­های تکمیلی در زمینه نقش miR-146a در مالتیپل میلوما و مسیرهای انتقال پیام پایین دست آن را خاطر نشان می­نماید.
    شیوع بالای مالتیپل میلوما در جهان و درصد بالای مرگ و میر ناشی از آن که به دلیل غیر قابل درمان بودن بدخیمی رخ می­دهد و هم چنین طولانی و پر هزینه بودن دوره درمان، لزوم تشخیص بیماری در مراحل اولیه و تعیین به موقع پیش‌آگهی بیماری را خاطر نشان می­نماید(21). از طرفی، پیشرفت­­های اخیر در علم بیولوژی سلولی و مولکولی سبب توسعه روش­های درمانی نوین در سرطان­ها گردیده است. در این روش­ها، اختلالات ژنتیکی و اپی‌ژنتیکی در مسیرهای پیام­دهی، به ویژه مسیرهای مؤثر در پاتوژنز بدخیمی، به عنوان هدف­های درمانی مورد استفاده قرار می­گیرند. درمان­های بر پایه اپی‌ژنتیک به ویژه هدف قرار دادن میکرو RNA ها، یک رویکرد درمانی نوین در مالتیپل میلوما به شمار می‌آید(4). از این رو مطالعه‌های گسترده­ای در زمینه شناسایی و تعیین عملکرد میکرو RNAهای مؤثر در مالتیپل میلوما صورت گرفته است(22). همانند نتایج به دست آمده از پژوهش حاضر، نقش سرکوبگری تومور برای میکرو RNA های دیگری از جمله let-7b-5p ، miR-186 ، miR-125b ، miR-145 ، miR-181a/b ، miR-222 ، miR-221 ، miR-382 ، miR-15a ، miR-16 ، miR-137/197 ، miR-29b ، miR-152 ، miR-10b-5p و miR-34c-3p در مالتیپل میلوما گزارش شده است(23). از طرفی، با نگاهی به مطالعه‌های انجام شده می­توان به آسانی دریافت که میکرو RNA ها با شرکت در فرآیندهای مهم بیولوژیکی از جمله پاسخ­های ایمنی ذاتی و اکتسابی، التهاب، سرنوشت سلولی، تکثیر، مرگ و مسیرهای انتقال پیام، نقشی کلیدی را در تکامل و عملکرد سلول­های ایمنی ایفا می­نمایند(16، 15، 4). یکی از میکرو RNA های مهم در سلول­های ایمنی، miR-146a است که تغییر در الگوی بیانی این میکرو RNA در بیماری­های التهابی و سرطان­های گوناگون به چشم می­خورد. بر اساس مطالعه‌های بولدین و همکارانش در سال 2011 ، با تکامل و فعال شدن سلول­های ایمنی، بیان miR-146a در این سلول­ها به شدت افزایش می­یابد، به همین دلیل حذف هدفمند miR-146a ، نقایص ایمنی مختلفی را به دنبال خواهد داشت. از سوی دیگر، miR-146a در کنترل تکثیر و تمایز سلول­های ایمنی دخیل می­باشد، به­گونه‌ای که موش‌های پیر فاقد miR-146a تولید مفرطی از سلول­های میلوئیدی را داشته و در ارگان­های لنفاوی ثانویه این موش­ها، تومورهای متعددی قابل ردیابی است. نتایج فوق مؤید نقش کلیدی miR-146a به عنوان یک سرکوبگر تومور در سیستم ایمنی و هم چنین مهارکننده مولکولی (molecular brake) در التهابات، تکثیر سلول­های میلومایی و ترانسفورماسیون انکوژنی است(20). در کنار پتانسیل مهارکنندگی تومور، گروهی از مطالعه‌ها به نقش انکوژنی miR-146a در بدخیمی­های خونی و تومورهای توپر اشاره دارند. برای مثال، بررسی­های استراسزینوسکی و همکاران در سال 2011 نشان داد ­که افزایش بیان miR-146a در ALL کودکان، AML ، سرطان­های سینه، پانکراس و پروستات دیده می­شود(24، 3). به منظور روشن­تر شدن نقش miR-146a در تقویت پتانسیل تومورزایی، گروهی از محققان به بررسی مسیرهای انتقال پیام پایین دست و بالا دست miR-146a پرداختند. بر طبق یافته­های مطالعه‌های انجام شده، القای بیان miR-146a در سلول با مهار رونویسی از دو مولکول عملگر مهم در مسیر NF-κB به نام­های IRAK1 و TRAF6 ، سبب کنترل منفی مسیر NF-κB می­گردد. غیر فعال شدن مسیر انتقال پیام مذکور با مهار تکثیر سلولی و القای آپوپتوز در سلول­ها همراه است. به عبارت دیگر، miR-146a قادر است تا با مهار کردن مسیرNF-κB  در سلول­های سرطانی، به عنوان یک مهارکننده رشد تومور عمل نماید(26، 25). از سویی، جمع‌بندی یافته­های مطالعه‌های انجام شده به نقش مسیر TGFβ/SMAD4 به عنوان سرکوبگر رشد تومور در بسیاری از سرطان­ها اشاره دارد. به طوری ­که مشاهده شده که با غیر فعال شدن SMAD4 ، به واسطه تاثیر میکرو RNA های مشخص بر آن و یا در اثر موتاسیون­های صورت گرفته در ژن SMAD4 ، مسیر TGFβ مهار می­گردد که این امر، پیشرفت بدخیمی را به دنبال خواهد داشت. با توجه به نقش تنظیمی miR-146a بر بیان ژن SMAD4 ، احتمال می‌رود که miR-146a با کاهش سطح پروتئینی SMAD4 و مهار مسیر TGFβ به عنوان یک محرک رشد تومور در سرطان­ها عمل نماید(28، 27). در مجموع، روشن شدن این موضوع که miR-146a با تاثیر بر کدام مسیرهای انتقال پیام، از رشد و تکثیر سلول­های میلومایی ممانعت نموده و سبب افزایش آپوپتوز در این سلول­ها می­گردد، مستلزم بررسی­های بیشتر در این زمینه می­باشد.
 
نتیجه‌گیری
    از آن ­جا که miR-146a به­ عنوان یکی از میکرو
RNAهای اثر گذار در شروع و پیشرفت بسیاری از بدخیمی­ها شناخته می­شود، در مطالعه حاضر میزان بیان این میکرو RNA در رده­های سلولی مرتبط با مالتیپل میلوما اندازه‌گیری و با لکوسیت­های طبیعی خون مقایسه گردید. آنالیز­ یافته­های مطالعه حاضر حاکی از آن است که miR-146a می­تواند به­عنوان یک سرکوبگر تومور در لکوسیت­ها عمل نموده و کاهش بیان این میکرو RNA در سلول­های میلومایی، به احتمال زیاد در آغاز و یا پیشرفت مالتیپل میلوما مؤثر می­باشد. هر چند به نظر می‌رسد عوامل متعددی از جمله ماهیت سلول­های بدخیم، مسیرهای انتقال پیام فعال شده و دیگر عوامل مؤثر بر تغییرات بیان ژن هم چون تغییرات اپی‌ژنتیکی، بر تعیین نوع اثرگذاری این میکرو RNA در روند بدخیمی و هم چنین نقش آن در سرطان­ها مؤثر ­باشد. این امر لزوم انجام بررسی­های تکمیلی در این زمینه را خاطر نشان می­نماید.
 
تشکر و قدردانی
    این پژوهش در قالب بخشی از پایان‌نامه دانشجویی و با مساعدت­های مالی دانشکده علوم پزشکی تربیت مدرس انجام گرفت است. از آقایان دکتر مسعود سلیمانی، امیر آتشی، نادر وظیفه شیران و فخرالدین صبا جهت مساعدت در تامین مواد و رده­های سلولی نهایت تشکر به عمل آورده می­شود.
ارسال پیام به نویسنده مسئول

ارسال نظر درباره این مقاله
نام کاربری یا پست الکترونیک شما:

CAPTCHA


XML   English Abstract   Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Kazemzadeh S, Farsinejad A, Sabour Takanlu J, Kaviani S, Atashi A, Soleimani M et al . miR-146a: A possible tumor suppressor in multiple myeloma. Sci J Iran Blood Transfus Organ. 2016; 13 (3) :224-232
URL: http://bloodjournal.ir/article-1-1014-fa.html

کاظم زاده شیما، فارسی نژاد علیرضا، صبور تکانلو جاوید، کاویانی سعید، آتشی امیر، سلیمانی مسعود و همکاران.. miR-146a : یک سرکوبگر احتمالی تومور در مالتیپل میلوما. فصلنامه پژوهشی خون. 1395; 13 (3) :232-224

URL: http://bloodjournal.ir/article-1-1014-fa.html



بازنشر اطلاعات
Creative Commons License این مقاله تحت شرایط Creative Commons Attribution-NonCommercial 4.0 International License قابل بازنشر است.
جلد 13، شماره 3 - ( پاييز 1395 ) برگشت به فهرست نسخه ها
فصلنامه پژوهشی خون Scientific Journal of Iran Blood Transfus Organ
The Scientific Journal of Iranian Blood Transfusion Organization - Copyright 2006 by IBTO
Persian site map - English site map - Created in 0.05 seconds with 31 queries by YEKTAWEB 4410