[صفحه اصلی ]   [Archive] [ English ]  
:: صفحه اصلي :: درباره نشريه :: آخرين شماره :: آرشيو مقالات :: جستجو :: ثبت نام :: ارسال مقاله :: تماس با ما ::
:: جلد 13، شماره 3 - ( پاييز 1395 ) ::
جلد 13 شماره 3 صفحات 176-184 برگشت به فهرست نسخه ها
بررسی مولکولی آنتی‌ژن نوتروفیلی – 3 در برخی اهداکنندگان خون
فاطمه شاهین، مژگان شایگان، شهرام سمیعی، بهناز بیات، فاطمه نادعلی، زهرا عطایی، محمد صیادی، آزیتا چگینی
تهران ـ ایران ـ صندوق پستی: 1157-14665
واژه‌های کلیدی: کلمات کلیدی: آنتی‌ژن‌های نوتروفیلی(HNAs)، HNA-3b، HNA-3a، ایرانیان، PCR-SSP، معادله هاردی وینبرگ
متن کامل [PDF 352 kb]   (1681 دریافت)     |   چکیده (HTML)  (5268 مشاهده)
نوع مطالعه: پژوهشي | موضوع مقاله: ايمونوهماتولوژي
انتشار: 1395/6/17
متن کامل:   (1091 مشاهده)
بررسی مولکولی آنتی‌ژن نوتروفیلی – 3 در برخی اهداکنندگان خون
 
فاطمه شاهین1، مژگان شایگان2، شهرام سمیعی3، بهناز بیات4، فاطمه نادعلی5، زهرا عطایی6،
محمد صیادی1، آزیتا چگینی7
 
 
چکیده
سابقه و هدف
آلوآنتی‌ژن‌های نوتروفیلی در بسیاری از عوارض انتقال خون, نظیر آسیب حاد ریوی پس از انتقال خون, مقاومت به تزریق گرانولوسیت‌ها و واکنش‌های تب‌زای انتقال خون دخالت دارند. به علت عدم وجود گزارش وفور این آنتی‌ژن‌ها، هدف این مطالعه بررسی فراوانیHNA-3a  وHNA-3b  در برخی اهداکنندگان خون ساکن تهران بود.
مواد و روش‌ها
در یک مطالعه توصیفی، از تعداد 110 اهداکننده خون مراجعه‌کننده به پایگاه انتقال خون استان تهران، نمونه خون حاوی ماده ضد انعقادی EDTA دریافت شد. DNA با استفاده از ستون فیلتردار سیلیکایی استخراج شد. برای بررسی HNA-3a و HNA-3b از روش PCR-SSP استفاده گردید و وفور ژنی آنتی‌ژن‌های HNA-3a و HNA-3b با استفاده از معادله هاردی واینبرگ محاسبه شد.
یافته‌ها
وفور ژنی HNA-3a و HNA-3b به ترتیب 74/0 و 26/0 حاصل گردید که با معادله هاردی واینبرگ تطابق دارد. از نظر فنوتیپی؛ 103 نفر(6/93%) دارایHNA-3a  , 7 نفر(4/6%) فاقد این آنتی‌ژن و 50 نفر(5/45%) دارایHNA-3b  و 60 نفر(5/54%) فاقد این آنتی‌ژن بودند. تفاوتی از نظر وفور ژنی و آنتی‌ژنی بین دو جنس مشاهده نشد.
نتیجه گیری
وفور ژنی HNA-3a و HNA-3b به دست آمده در این مطالعه با سایر مطالعه‌های انجام شده در آلمان و ترکیه مشابه می‌باشد.
کلمات کلیدی: آنتی‌ژنHNA-3a انسانی، اهداکنندگان خون، EDTA
 
 
 
 
تاریخ دریافت: 7 /9/94
تاریخ پذیرش: 11/2/95
 

1- کارشناس ارشد خون‌شناسی و بانک خون ـ مرکز تحقیقات انتقال خون ـ مؤسسه عالی آموزشی و پژوهشی طب انتقال خون ـ تهران ـ ایران
2- مؤلف مسئول: PhD ایمونولوژی ـ دانشیار مرکز تحقیقات انتقال خون ـ مؤسسه عالی آموزشی و پژوهشی طب انتقال خون ـ تهـران ـ ایران ـ صندوق پستی: 1157-14665
3- کارشناس ارشد بیوشیمی ـ مربی مرکز تحقیقات انتقال خون ـ مؤسسه عالی آموزشی و پژوهشی طب انتقال خون ـ تهران ـ ایران
4- PhD ایمونولوژی ـ مؤسسه ایمونولوژی بالینی و طب انتقال خون Justus Liebig دانشگاه Giessen ـ آلمان
5- PhD خون‌شناسی و بانک خون ـ دانشیار دانشکده پیراپزشکی دانشگاه علوم پزشکی تهران ـ تهران ـ ایران
6- دانشجوی کارشناس ارشد بیوشیمی ـ مرکز تحقیقات انتقال خون ـ مؤسسه عالی آموزشی و پژوهشی طب انتقال خون ـ تهران ـ ایران
7- متخصص بیهوشی ـ استادیار مرکز تحقیقات انتقال خون ـ مؤسسه عالی آموزشی و پژوهشی طب انتقال خون ـ تهران ـ ایران
 

 
مقدمه
    آنتی‌ژن‌های نوتروفیلی انسان(Human Neutrophil Antigens= HNAs) و آنتی‌بادی‌های مربوطه و عدم شباهت آن‌ها بین اهداکننده و دریافت کننده خون و یا مادر و جنین، منجر به وضعیت‌های بالینی مختلفی مثل نوتروپنی ایمیون نوزادان(ANN: Alloimmune neonatal neutropenia), آسیب حاد ریوی مربوط به انتقال خون(TRALI: Transfusion Related Acute Lung Injury), مقاومت به تزریق گرانولوسیت, واکنش‌های تب‌زای انتقال خون و نوتروپنی پس از پیوند سلول‌های بنیادی خونساز می‌شود. این آنتی‌ژن‌ها و آنتی‌بادی‌ها در بروز نوتروپنی دارویی و اتوایمیون نیز دخالت دارند.  
    HNAs مختلف از نظر ساختمانی و عملکرد متفاوت می‌باشند(5-1). هفت آنتی‌ژن در 5 گروه یا سیستم مشخص شده‌اند, که طبق نام‌گذاری منطبق بر مقررات ISBT (International Society of Blood Transfusion)، نام‌گذاری و تقسیم شده‌اند(1)(جدول 1). در سال 2013 نیز HNA-1d توسط خانم رایلی معرفی شد که در نوتروپنی ایمیون نوزادان نقش دارد(6).
    پلی‌مورفیسم آلوآنتی‌ژن‌های نوتروفیلی HNA ، باعث بسیاری از اختلالات بالینی آلوایمیون و اتوایمیون می‌شود(7). نقش آنتی‌ژن‌های نوتروفیلی علاوه بر ایجاد ناسازگاری‌ها, اعمال طبیعی نوتروفیل‌ها مثل پاکسازی کمپلکس آنتی‌ژن ـ آنتی‌بادی به عنوان بخشی از قسمت ثابت گیرنده ایمنوگلوبولین Fc Gamma Receptor می‌باشد.  اما هنوز مشخص نشده که آیا پلی‌مورفیسم این آنتی‌ژن‌ها نیز در عملکرد نوتروفیل‌ها اثری دارد یا خیر؟(8).
    فنوتیپ HNA null در بعضی از بیماران باعث تمایل به عفونت‌های مکرر و بیماری‌های اتوایمیون می‌شود(9). 
    آنتی‌ژن HNA-3a در سال 1964 به وسیله لیوون معرفی شد. او مطرح نمود که این آنتی‌ژن روی گلیکوپروتئین 70 تا 90 کیلو دالتون CTL-2 (Choline Transporter-Like peptide) وجود دارد. این آنتی‌ژن قبلاً HNA-5b  اطلاق می‌شد(12-10). HNA-3a و HNA-3b حاصل پلی‌مورفیسم منفرد نوکلئوتیدی(SNP = Single Nocleotide Polymorphism ) ژن SLC44A2 کدکننده CTL-2 روی کروموزوم 19p13.1 می‌باشند که طی آن گوانین موقعیت 461 با آدنین جایگزین شده و باعث تغییری در CTL-2 گلیکوپروتئینی در عرض غشاء می‌شود(14، 13). در این تغییر آرژنین موقعیت 154 (در HNA-3a) به گلوتامین(در HNA-3b) تبدیل می‌شود. HNA-3 در نوتروفیل‌های روی لنفوسیت‌ها, پلاکت‌ها, سلول‌های اندوتلیال, کلیه, طحال, سلول‌های جفت, منوسیت‌ها و بافت لنفاوی نیز دیده می‌شود(15، 12، 11).
    تصور می‌شود CTL-2 دارای 10 قلمرو(domain) در عرض غشاء و 5 قلمرو خارج سلولی است(16). تعداد  HNA-3a روی لنفوسیت‌ها و نوتروفیل‌ها برابر گزارش شده‌اند و تعداد این آنتی‌ژن‌ها در افراد هتروزیگوت به میزان 50% از آنتی‌ژن‌های یک فرد هموزیگوت می‌باشند(16). جایگزینی دیگری بین سیتوزین با تیمین در در موقعیت 153 در سطح نوکلئوتیدی، منجر به جابه‌جایی  اسید آمینه لوسین با فنیل‌آلانین(در موقعیت 457) شده که در اولین حلقه یا دومین خارجی پروتئین صورت می‌گیرد و اتصال به آنتی‌بادی و حتی تعیین ژنوتیپ را تحت تاثیر قرار داده و ممکن است منجر به عدم تعیین ژنوتیپ گردد(14). 
    توزیع آلل‌های سیستم HNA در جمعیت‌های مختلف با استفاده از چندین روش تعیین ژنوتیپ بررسی شده است(19-17، 5). بررسی فنوتیپی HNAs  به روش‌های‌ آگلوتیناسیون و ایمونوفلورسانس انجام می‌شود(20، 18). اما به دلیل نیاز به نوتروفیل‌های تازه، سختی دسترسی به آنتی‌بادی‌های مربوطه و دقت کمتر روش‌های سرولوژیک, امروزه این روش‌ها با روش‌های مولکولی جایگزین شده‌اند. در روش‌های مبتنی بر ایمونوفلورسانس برای بررسی فنوتیپی گرانولوسیت‌ها نیز دسترسی به آنتی‌بادی‌های ضد HNA (به ویژهHNA-3/-4/-5) مشکل است اما آنتی‌بادی‌های ضد HNA-1a/-1b/-2a به صورت تجاری و به روش فلوسیتومتری موجود هستند که روش اخیر نسبت به روش سرولوژیک سریع‌تر و ساده‌تر می‌باشد(21، 5-1).
    آنتی‌بادی‌های ضد HNA-2a و HNA-1a در بروز TRALI  دخالـت دارنـد اما آنتی‌بادی‌های ضد HNA-3  در
 

جدول 1: ویژگی آنتی‌ژن‌های نوتروفیلی(13)
 
گروه‌های آنتی‌ژنی آنتی‌ژن‌ها نام قبلی CD مارکر ژن کد کننده آلل اهمیت بالینی
HNA-1 HNA-1a NA1 FcγRIIIb/CD16b FCGR3B*01 ANN,AIN,TRALI,ς
HNA-1b NA2 FcγRIIIb/CD16b FCGR3B*02
HNA-1c SH FcγRIIIb/CD16b FCGR3B*03
HNA-2 HNA-2a NB1 58-64 kDa/CD177 Unknown ANN,AIN,TRALI
Febrile transfusion reactions, drug-dependent neutropenia
HNA-3 HNA-3a 5b CTL2/Unknown   ANN,TRALI, febrile transfusion reactions
HNA-3b 5a CTL2/Unknown  
HNA-4 HNA-4a MART CR3/CD11b
(α M subunit)
ITGAM*01
(230G)
ANN
HNA-5 HNA-5a OND LFA-1/CD11a
(α L subunit)
ITGAL*01
(2372G)
Unknown
 
 
بروزTRALI  شدید منجر به مرگ, حتی در افراد سالم, مؤثر شناخته شده‌ است(22). دوران و رایلی بروزTRALI  را ناشی از حضور آنتی‌بادی‌هایHNA-3a  در اهداکنندگان دانسته‌اند که انتقال این آنتی‌بادی‌ها می‌تواند منجر به مرگ و میر شود. اتصال آنتی‌بادی‌های HNA-3 منجر به تثبیت آنتی‌ژن HNA-3a ، تغییر شکل فضایی آن و تجمع (آگلوتیناسیون) نوتروفیل‌ها می‌گردد که مرحله مهمی در بروز این عارضه است(24، 23). ایمن شدن زنان اهداکننده خون با فنوتیپ -3b ، HNA-3b علیه HNA-3a طی حاملگی 7/0% گزارش شده است(25). تعیین ژنوتیپ آنتی‌ژن‌های HNA-3a  تا سال 2007 و تعیین ویژگیHNA-3b  در سال 2010 مقدور شدند(21، 12). در یک مطالعه وفور آنتی‌ژن HNA-3a برابر 792/0 و وفور آنتی‌ژن HNA-3b معادل 207/0 اعلام شد، اما در مطالعه‌های مختلف در جمعیت‌های گوناگون، فراوانی متفاوتی از آن‌ها گزارش شده است(36-26، 19، 12، 4). با توجه به نقش این آنتی‌ژن‌ها در تحریک ایجاد آنتی‌بادی و دخالت در برخی عوارض انتقال خون و عدم وجود اطلاعات در این زمینه در اهداکنندگان خون در کشور، هدف اصلی این مطالعه به عنوان قدم اول, بررسی وفور آنتی‌ژن‌های -3b ،HNA-3a در برخی اهداکنندگان خون به روش PCR-SSP (Sequence-Specific Primer-Polymerase Chain Reaction) بود.
 
مواد و روش‌ها
    مطالعـه انجـام شـده از نـوع تـوصیفی بود. mL 5 خون
کامل از 110 نفر از اهداکنندگان خون مراجعه‌کننده به پایگاه انتقال خون تهران در لوله‌های حاوی ضد انعقاد EDTA در حین نمونه‌گیری برای انجام آزمایش‌های غربالگری خون در حین اهدای خون, جمع‌آوری گردید. نمونه‌گیری به صورت تصادفی انجام شد. نمونه‌ها در دمای محیط و سریعاً به آزمایشگاه منتقل شدند و در فاصله 2-3 ساعت از نمونه‌گیری, استخراج DNA از گلبول‌‌های سفید موجود در بافی‌کوت(با استفاده از ستون فیلتردار سیلیکایی در کیت GeNet Bio محصول کشور کره) انجام شد. بـرای تعیین ژنوتیپ HNA-3a,3b از روش PCR-SSP استفاده گردید. دو لوله واکنش جداگانه، برای تعیین ژنوتیپ دو آلل مورد نظر HNA-3a,3b استفاده شد. توالی آغازگرها به شرکت تکاپو زیست سفارش داده شدند. حجم کلی محتـوای واکنـش، 20 میکرولیتر(شامل 6 میکرولیتر نمونه DNA ، 10 میکرولیتر از مخلوط واکنش و نوکلئوتیدها و 4 میکرولیتر از مخلوط آغازگرها و نوکلئوتیدها) در هر لوله بود. مخلوط آغازگرها شامل آغازگر مخصوص آلل(allele specific primer)، آغازگر مشترک دو آلل(common primer)، یک جفت آغازگر هورمون رشد(HGH یا Human Growth Hormon), به عنوان کنترل مثبت واکنش PCR و O2dH بود که مقدار مصرفی هر کدام بسته به غلظت نهایی مورد نظر برای آن آغازگر داشت. مقـدار آنزیـم DNA تک پلیمراز(Units 1000 ، رُوش) بـرای هـر واکنـش 3/0 میکـرولیتر بود که به صـورت کلـی بـرای هر
 

جدول 2: توالی آغازگرها، اندازه، غلظت نهایی و اندازه مورد انتظار برای محصولات تکثیری در هر آنتی‌ژن
 
سیستم آنتی‌ژن اندازه
(bp)
غلظت نهایی (µM) توالی اندازه محصول (bp)
HNA-3 3a پیش‌برنده 18 1 5' AGTGGCTGAGGTGCTTCG 3' 601
3b پیش‌برنده 19 5' GAGTGGCTGAGGTGCTTCA 3'
معکوس 18 5' ATCGCCATGGCAATGACCA 3'
HGH پیش‌برنده 22 125/0 5' TGCCTTCCCAACCATTCCCTTA 3' 434
معکوس 29 5' CCACTCACGGATTTCTGTTGTGTTTC 3'
 
 
دوره واکنش محاسبه گردید و در مخلوط واکنش اضافه شد. مخلوط واکنش شامل: 10 میکرولیتر از x Master Mix 2 برای هر لوله واکنش می‌‌باشد. غلظت نهایی 2MgCl در همه واکنش‌ها 5/1 میکرومولار در نظر گرفته شد.  Master Mix دست‌ساز در آزمایشگاه کیت‌سازی آزمایشگاه تشخیص طبی سازمان انتقال خون ایران است و پس از بررسی‌های لازم غلظت و ترکیب آن مشخص شد.
    پس از 10 دقیقه انکوباسیون در دمای 94 درجه سانتی‌گراد، مراحل PCR زیر انجام شد:‌ (35 سیکل: 94 درجه سانتی‌گراد به مدت 20 ثانیه، 57 درجه سانتی‌گراد به مدت 20 ثانیه، 72 درجه سانتی‌گراد به مدت 20 ثانیه و 1 سیکل: 4 درجه سانتی‌گراد به مدت 3 دقیقه). پس از انجام مراحل تکثیر، محصولات PCR روی ژل آگارز 2% الکتروفورز شده و با استفاده از رنگ‌آمیزی اتیدیوم بروماید و ترانس ایلومیناتورUV  مشاهده و بررسی شدند(جدول 2). غلظت آغازگرهای HGH که به عنوان کنترل داخلی در هر واکنش لحاظ شده‌اند طوری محاسبه گردیده که کمتر از آغازگرهای آنتی‌ژن‌های نوتروفیلی باشند و لذا زمانی که تکثیر آنتی‌ژن‌های نوتروفیلی به صورت مطلوب انجام شود، تکثیر ژن HGH هم انجام می‌شود و رقابت نمی‌کنند، در نتیجه وجود باندی از HGH به عنوان کنترل داخلی تایید کننده صحیح بودن روند آزمایش و مواد مورد استفاده می‌باشد. در مقابل آن وجود باند واضح دیگر با اندازه bp 601 ، دلیل حضور آنتی‌ژن نوتروفیلی است. در صورت فقدان چنین باندی، تنها در حالتی جواب را منفی و به عنوان عدم حضور آلل تلقی می‌کنیم که تکثیر ژن HGH صورت گرفته و باندی به اندازه bp 434 در ردیف مشاهده شود. حضور این باند به تنهایی به معنای انجام واکنش تکثیر و عدم حضور آلل مربوطه است. باندهای مربوط به آلل‌ها با استفاده از سایز مارکر و مقایسه آن با باند موجود در هر ردیف تشخیص داده شدند. با مشاهده یا عدم مشاهده باند مورد نظر، موارد مثبت و منفی یادداشت شده و سپس وفور موارد مشاهده شده و مطابقت آن با قانون هاردی واینبرگ با استفاده از آزمون آماری c2 بررسی گردید. در صورت کمتر بودن p از 05/0, یعنی وفور موارد مشاهده شده با قانون هاردی واینبرگ تطابق ندارد اما در صورت عدم اختلاف، یعنی موارد مشاهده شده با قانون هاردی واینبرگ مطابق دارد و با وارد کردن فراوانی آللی موارد هموزیگوت و هتروزیگوت در محاسبه‌گر هاردی واینبرگ، وفور آلل‌های a و b برای HNA-3 به دست می‌آیند. برای مقایسه فراوانی نسبی ژن‌ها در جمعیت‌هـای مختلف از آزمون کای‌دو استفاده شد.
 
یافته‌ها
    نمونه‌های خون کامل از 110 اهداکننده خون مراجعه‌کننده به پایگاه انتقال خون استان تهران (مرکز وصال) در محدوده سنی 19 الی 64 سال(10 ± 57/43) شامل 6 زن(45/5%) و 104 مرد(55/94%), در این مطالعه ارزیابی شدند. 103 نفـر(6/93%) دارایHNA-3a  , 7 نفـر(4/6%) فاقد این آنتی‌ژن و 50  نفر(5/45%) دارای HNA-3b و 60 نفر (5/54%) فاقد این آنتی‌ژن بودند(جدول
3).
جدول 3: جدول دوگانه HNA-3a*HNA-3b
 
آلل HNA-3b جمع
+ -
HNA-3a - HNA-3a-3b+ HNA-3a-3a- 7
7 0
+ HNA-3a+3b+ HNA-3a+3a+ 103
43 60
جمع 50 60 110
 
    مشخص شد از 103 نفری که HNA-3a را دارند, 43 نفر(1/39%) هتروزیگوت HNA-3a/3b (شامل 3 زن و 40 مرد), 60 نفر(5/54%) هموزیگوت HNA-3a/3a (شامل 3 زن و 57 مرد) و از 50 نفری که HNA-3b را دارند, 7 نفر(4/6%) هموزیگوت HNA-3b/3b (همگی مرد) بودند. وفور موارد مشاهده شده به علت بزرگتر بودن عدد p از 05/0 ، با قانون هاردی واینبرگ تطابق داشت و لذا طبق معادله هاردی واینبرگ، فراوانی ژنی HNA-3a   برابر 74/0 و فراوانی ژنی HNA-3b برابر 26/0 در جمعیت مورد مطالعه بود. تفاوتی بین وفور آنتی‌ژن‌ها بین دو جنس مشاهده نشد(فراوانی ژنیHNA-3a  برابر 73/0 در مردان و 75/0 در زنان و HNA-3b برابر 27/0 در مردان و 25/0 در زنان مشاهده شدند).
      

 
شکل a -1) نتایج الکتروفورز محصول PCR-SSP مربوط به ژن HNA-3a : ستون 7 کنترل منفی بدون DNA می­باشد. باند 434bp مربوط به HGH است که در تمام ستون­ها مثبت شده است. باند 601bp مربوط به HNA-3a می­باشد که در تمام ستون­ها به جز 4 مشاهده می‌شود. ستون اول سایز مارکر bp 50 است.

 
 

شکل b-1: نتایج الکتروفورز محصول PCR-SSP  مربوط به ژن HNA-3b  : ستون 8 کنترل منفی بدون DNA می­باشد. باند bp 43 مربوط به HGH می­باشد که در تمام ستون­ها مثبت شده است. باند bp 601 مربوط به HNA-3ab می­باشد که در تمام ستون­ها به جز 4  مشاهده می‌شود. ستون اول سایز مارکر bp 50 است.
 
    آن چه مهم است این است که در شش فرد مؤنث مورد بررسی در این مطالعه، مواردی از هموزیگوتHNA-3b/3b  مشاهده نگردید. نتایج الکتروفورز محصول PCR-SSP برای آلل‌های b3 ، HNA-3a در شکل 1 (b و a) نشان داده شده‌ است.
 
بحث
    نتایج این بررسی نشان داد که وفور ژنیHNA-3a  برابر 74/0 و فراوانی ژنیHNA-3b  معادل 26/0 می‌باشد. نورسیا و همکاران در سال 2009 به بررسی شیوع فنوتیپ‌های  HNA-1a,-1b , -2 , -3a , -4a در 100 فرد برزیلی به روش GIFT به وسیله فلوسیتومتری پرداختند و نتایج نشان‌دهنده فراوانی فنوتیپ HNA-3a ، 95% بود(31). در حالی که فنوتیپ HNA-3a در 103 نفر (6/93%) از افراد مطالعه حاضر مشاهده شد و این اختلاف بین دو جمعیت معنادار نبود.
   هاک بی و همکاران در سال 2011 شیوع 5- ، 4- ، 3- ، HNA-1 را در 119 اهداکننده خون در آلمان و 118 اهداکننده ترک مهاجر به آلمان, به وسیله روش PCR-SSP بررسی و نتایج را با هم مقایسه نمودند. فراوانی در آلمانی‌ها برای HNA-3a معادل 744/0 و برای HNA-3b برابر 25/0 و در جمعیت ترکیه 737/0 برایHNA-3a   و 263/0 برای HNA-3b مشاهده شد که تفاوت چشمگیر آماری بین دو گروه مشاهده نشد و نتایج حاکی از آن بود که رد و بدل کردن خون و فرآورده‌های آن بین این افراد دو کشور، باعث گسترش آلوآنتی‌بادی بر ضد آنتی‌ژن‌های نوتروفیلی نمی‌شود و در حاملگی‌ها طی ازدواج بین زوج‌هایی از این دو کشور، نیازی به غربالگری خاصی برای HNA ندارد(32).
    ماتسوهاشی و همکاران در سال 2012 به بررسی شیوع 5- ، 4- ، 3- ، 2- ، 1-HNA در570 فرد سالم در ژاپن با استفاده از روش‌های مولکولی و سرولوژیک پرداختند. ژنوتیپ  1-HNA به روش PCR-rSSOP (polymerase chain reaction-reverse sequence - specific oligonucleotide probes ) ارزیابی شد و 5 ، 4، HNA-3 به روش PCR-SSP با کمی تغییر بررسی شدند. HNA-2 با روش GIFT در 300 ژاپنی بررسی شد که فراوانی HNA-3a و HNA-3b به ترتیب 654/0 و 346/0 بود(33).     کاردوسو و همکاران در سال 2013 به بررسی شیوع 5- ، 4- ، 3- ، 1-HNA در140 سفیدپوست اهداکننده خون در انگلستـان پـرداختند، بررسی با استفاده از روش multiplex

Luminex bead assay انجام شد و فراوانی HNA-3a و HNA-3b به ترتیب 768/0 و 232/0 به دست آمد(34).
    چانگسری و همکاران در سال 2013 به بررسی شیوع 5- ، 4- ، 3- ، 1-HNA در 300 نفر از اهداکنندگان خون در محدوده سنی 18 تا 58 سال در تایلند پرداختند. برای 4- ، 3- ، 1-HNA از روش PCR-SSP و برای 5-HNA از روش PCR-RFLP بهره بردند. نتایج این مطالعه وفور 49/0 را برای HNA-3a و 51/0 را برای  HNA-3bنشان داد(35).
    جدول 4 نتایج مقایسه وفور فراوانی مشاهده شده این ژن‌ها در جمعیت مورد مطالعه با جمعیت‌های آلمانی, ترکیه‌ای, ژاپنی, تایلندی و انگلیسی را نشان می‌دهد. مقایسه وفور -3b ، HNA-3a (26/0 ، 74/0) در جمعیت مورد مطالعه در تحقیق حاضر با مطالعه‌های قبلی در جوامع دیگر نشان می‌دهد که به فراوانی این دو آلل در آلمان, ترکیه, انگلیس شبیه و با وفور گزارش شده این آلل‌ها در تایلند و ژاپن متفاوت به نظر می‌رسند. اما با وفور این آلل‌ها در چین، این اختلاف با 1/0 p< معنادار است.     گزارش‌هایی نیز از موارد HNA-3a-/3b وجود دارد, که در واقع به علت وقوع موتاسیون در موقعیت 457 به نظر می‌رسد که بر تعیین ژنوتیپ اثر می‌کند(38، 37).
 
 
جدول 4: مقایسه وفور ژنی HNA-3a/3b بین جمعیت‌های مختلف
 
کشور سال تعداد نمونه / روش کار فراوانی نسبی
 HNA-3a
فراوانی نسبی
 HNA-3b
p value
آلمان 2011
(33)
119 آلمانی و 118 ترکیه
PCR-SSP
744/0 256/0 92/0
737/0 263/0 89/0
ژاپن 2012
(34)
570
PCR-SSOP
654/0 346/0 039/0
انگلستان 2013
(35)
140
Multiplex Luminex DNA base assay
768/0 232/0 73/0
تایلند 2013
(36)
300
PCR-RFLP
49/0 51/0 0001/0
چین 2013
(37)
400
PCR-SSP
654/0 346/0 059/0
مطالعه حاضر 2015 110
PCR-SSP
74/0 26/0 -


 
در سال 2009 طی گزارشی در مورد افراد غیر خویشاوند با فنوتیپ منفی HNA-3a ، مطرح شد که این افراد دارایSNP  (پلی‌مورفیسم نوکلئوتید منفرد) در نوکلئوتید 542 ژن SLC44A2 کدکننده CTL-2 می‌باشند(38). برای صحت اطمینان از موارد منفی, بررسی توالی نوکلئوتیدی توصیه می‌شود.
 
نتیجه‌گیری
    در این مطالعه مواردی از HNA-3b/3b در بین زنان  مورد مطالعه یافت نشد اما به دلیل تعداد اندک آن‌ها توصیه می‌شود در تعداد بیشتری از زنان، بررسی انجام شود. هم چنین در مطالعه حاضر مواردی نیز از HNA-3b  نول مشاهده نشدند. با توجه به گزارش مواردی از هموزیگوت HNA-3b/3b در برخی افراد و وفور HNA-3a ، بررسی آنتی‌بادی‌های HNA-3a در موارد کراس‌مچ مثبت و قبل از تزریق مفید به نظر می‌رسد.
 
تشکر و قدردانی
    این تحقیق بخشی از یافته‌های پایان‌نامه دوره کارشناسی ارشد مصوب در مرکز تحقیقات انتقال خون، مؤسسه عالی آموزشی و پژوهشی طب انتقال خون می‌باشد.
ارسال پیام به نویسنده مسئول

ارسال نظر درباره این مقاله
نام کاربری یا پست الکترونیک شما:

CAPTCHA


XML   English Abstract   Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Shahin F, Shaiegan M, Samie S, Bayat B, Nadali F, Ataei Z, et al . Molecular evaluation of Human Neutrophil Antigen (HNA-3) in some blood donors. Sci J Iran Blood Transfus Organ. 2016; 13 (3) :176-184
URL: http://bloodjournal.ir/article-1-1002-fa.html

شاهین فاطمه، شایگان مژگان، سمیعی شهرام، بیات بهناز، نادعلی فاطمه، عطایی زهرا، و همکاران.. بررسی مولکولی آنتی‌ژن نوتروفیلی – 3 در برخی اهداکنندگان خون . فصلنامه پژوهشی خون. 1395; 13 (3) :176-184

URL: http://bloodjournal.ir/article-1-1002-fa.html



بازنشر اطلاعات
Creative Commons License این مقاله تحت شرایط Creative Commons Attribution-NonCommercial 4.0 International License قابل بازنشر است.
جلد 13، شماره 3 - ( پاييز 1395 ) برگشت به فهرست نسخه ها
فصلنامه پژوهشی خون Scientific Journal of Iran Blood Transfus Organ
The Scientific Journal of Iranian Blood Transfusion Organization - Copyright 2006 by IBTO
Persian site map - English site map - Created in 0.05 seconds with 31 queries by YEKTAWEB 4341