[صفحه اصلی ]   [Archive] [ English ]  
:: صفحه اصلي :: درباره نشريه :: آخرين شماره :: آرشيو مقالات :: جستجو :: ثبت نام :: ارسال مقاله :: تماس با ما ::
:: جلد 15، شماره 1 - ( بهار 1397 ) ::
جلد 15 شماره 1 صفحات 28-35 برگشت به فهرست نسخه ها
بیان LncRNA HOX transcript antisense RNA در بیماران تازه تشخیص داده شده لوسمی لنفوبلاستیک حاد
دکتر پرویز فلاح، مجتبی ملایی، دکتر علی احسان حیدری، دکتر مسعود سلیمانی، مهدی جاهدی برزگر، دکتر احسان عارفیان، طاهره مدنی، دکتر موژان اسدی، دکتر بهزاد پوپک*
PhD هماتولوژی و بانک خون تهران ـ ایران
واژه‌های کلیدی: کلمات کلیدی: خونسازی، LncRNA، لوسمی لنفوبلاستیک حاد
متن کامل [PDF 722 kb]   (110 دریافت)     |   چکیده (HTML)  (626 مشاهده)
نوع مطالعه: پژوهشي | موضوع مقاله: هماتولوژي
متن کامل:   (44 مشاهده)
بیان LncRNA HOX transcript antisense RNA در بیماران
تازه تشخیص داده شده لوسمی لنفوبلاستیک حاد
 
پرویز فلاح1، مجتبی ملایی2، علی احسان حیدری3، مسعود سلیمانی4، مهدی جاهدی زرگر5، احسان عارفیان6،
طاهره مدنی7، موژان اسدی8، بهزاد پوپک9
 
 
چکیده
سابقه و هدف
لوسمی حاد لنفوبلاستی، شایع‌ترین بدخیمی دوران کودکی می‌باشد. سالانه در کل دنیا به ازای هر 100 هزار نفر،1 تا 7/4 نفر به این بیماری مبتلا می‌شوند. Long non-coding RNA ها (lncRNAs)، گروهی از RNAهای غیرکدشونده هستند که در فرآیندهای زیستی از جمله تغییرات اپی‌ژنتیکی، کنترل رونویسی و ترجمه نقش دارند. استفاده از lncRNA های اختصاصی خونی و شناسایی عملکرد آن‌ها می‌تواند در شناخت بیشتر پاتوفیزیولوژی این بیماری و به دنبال آن در درمان کمک‌کننده باشد. از جمله lncRNA های مهم در روند خونسازی، LncRNA HOX transcript antisense RNA (HOTAIR) می‌باشد. هدف از انجام این مطالعه، بررسی میزان بیان آن در بیماران تازه تشخیص داده شده لوسمی لنفوبلاستیک حاد رده سلولی B (B-ALL)بود.
مواد و روش‌ها
در یک مطالعه توصیفی ـ مقطعی، میزان بیان HOTAIR در نمونه مغز استخوان 40 بیمار تازه تشخیص داده شده B-ALL و هم چنین در 15 فرد سالم به عنوان گروه کنترل با روش‌Real Time PCR  سنجیده شد. یافته‌ها توسط برنامه REST 2009، تجزیه و تحلیل شدند.
یافته‌ها
میـزان بیـان HOTAIR در گـروه بیماران نسبت به گروه کنترل به طور معناداری 121 برابر افزایش داشت (05/0 p<).
نتیجه گیری
میزان بیان افزایشی HOTAIR در  لوسمی لنفوبلاستیک حاد نوع B می‌تواند پیشگوکننده این باشد که افزایش بیان آن با پاتوفیزیولوژی این بیماری در ارتباط می‌باشد. اگر چه به مطالعه‌های بیشتری جهت بررسی میزان بیان آن در لوسمی‌های دیگر و مشخص کردن نقش آن نیاز می‌باشد.
کلمات کلیدی: خونسازی، LncRNA ، لوسمی لنفوبلاستیک حاد
 
 
 
تاریخ دریافت: 31/5  /96
تاریخ پذیرش:  24/11/96
 

1- PhD هماتولوژی و بانک خون ـ استادیار دانشکده پیراپزشکی ـ دانشگاه علوم پزشکی البرز ـ کرج ـ ایران
2- کارشناس علوم آزمایشگاهی ـ مرکز تحقیقات بن‌یاخته ـ تهران ـ ایران
3- PhD انگل‌شناسی پزشکی ـ دانشیار دانشکده پزشکی ـ دانشگاه علوم پزشکی البرز ـ کرج ـ ایران
4- PhD هماتولوژی و بانک خون ـ دانشیار دانشکده پزشکی دانشگاه تربیت مدرس ـ تهران ـ ایران
5- دانشجوی دکترای تخصصی هماتولوژی و بانک خون ـ دانشکده پیراپزشکی دانشگاه علوم پزشکی البرز ـ کرج ـ ایران
6- PhD ویروس‌شناسی پزشکی ـ استادیار دانشکده زیست‌شناسی دانشگاه تهران ـ تهران ـ ایران
7- کارشناس ارشد هماتولوژی و بانک خون ـ آزمایشگاه تشخیص طبی و تخصصی پیوند ـ تهران ـ ایران
8- فوق تخصص خون و انکولوژی بالغین ـ استادیار دانشکده پزشکی دانشگاه علوم پزشکی البرز ـ کرج ـ ایران
9- مؤلف مسئول: PhD هماتولوژی و بانک خون ـ دانشیار دانشگاه آزاد اسلامی واحد پزشکی تهران ـ تهران ـ ایران ـ صندوق پستی: 1495-19395
 

مقدمه
    لوسمی حاد لنفوبلاستیک(ALL)، در اثر تجمع لنفوبلاست‌ها در مغز استخوان ایجاد شده و شایع‌ترین بدخیمی دوران کودکی می‌باشد(1). سالانه در کل دنیا به ازای هر 100 هزار نفر، 1 تا 7/4 نفر به این بیماری مبتلا می‌شوند(2). بیشترین میزان بروز ALL در سنین بین ۳ الی ٧ سالگی بوده، حدود ٧۵% موارد آن قبل از ۶ سالگی رخ می‌دهند. میزان شیوع بعدی ALL بعد از ٤۰ سالگی می‌باشد(3). در 85% از موارد رده سلولی گرفتار از نوعB (B-ALL) بوده و میزان بروز آن در هر دو جنس یکسان است. رده سلولی درگیر در ۱۵% بقیه از نوع T (T-ALL) می باشد.
    RNAهای غیر کدشونده را می‌توان به دو دسته کلی ncRNA های کوچک مانند میکروRNAها (miRNA) و ncRNA های بلند(LncRNA) تقسیم‌بندی کرد(4). محتوای رونویسی پستانداران شامل تعداد بسیار زیادی رونوشت به نام RNA غیر کدشونده بلند(LncRNA) می‌باشد که این RNAها طولی بیش از 200 نوکلئوتید دارند و پروتئینی از این گروه از RNA ها ترجمه نمی‌شود(5). این گروه در پروسه‌های زیستی بسیاری نقش‌های مهمی ایفا می‌کنند از این جمله می‌توان به نقش LncRNA ها در ایجاد تغییرات اپی‌ژنتیکی، به هم پیوستن mRNA، کنترل ترجمه و کنترل رونویسی اشاره کرد(9-6). مطالعه‌ها نشان داده‌اند که تغییر و یا نقص در بیان این LncRNA با پیش‌آگهی، متاستاز و ایجاد بدخیمی‌ها در ارتباط است، به طور مثال افزایش بیان در LncRNA که نقش پروتو- انکوژن در سلول‌های طبیعی ایفا می‌کنند، سبب افزایش رشد تومور و ماتریکس آن، افزایش متاستاز و افزایش تکثیر سلول‌های بدخیم می‌شوند(12-10). در انواع زیر گروه‌های لوسمی لنفوئیدی حـاد، پـاتوژنز دقیـق بیماری کامل مشخص نشده است(13). شناسایی عملکرد و نقشLong non-coding RNAهای اختصاصی خونی در پاتوفیزیولوژی لوسمی لنفوبلاستک حاد می‌تواند در ارائه راه‌کارهای درمانی این بیماری کمک‌کننده باشد. با توجه به بررسی مقاله‌های متعدد از جمله LncRNA های تنظیمی مهم در سیستم خونساز، HOTAIR می‌باشد. HOTAIR اولین بار توسط رین و همکارانش به عنوان یک RNA پلی‌آدنیله که ۲۱۵۸ نوکلئوتید و ۶ اگزون دارد معرفی شد(14). در واقع HOTAIR نقش مهمی در تکثیر، آپوپتوز، تهاجم، متاستاز و حرکت سلول‌های بدخیم دارد(10). هدف از انجام این مطالعه با توجه به نقش‌های مهم و تعداد ژن‌های هدف زیاد HOTAIR در روند خونسازی، بررسی میزان بیان آن در بیماران ALL بود که می‌تواند در تعیین نقش آن در پاتوژنز و به دنبال آن در درمان این بیماری کمک‌کننده باشد.
 
مواد و روش‌ها
جمع‌آوری نمونه‌های بیماران و افراد سالم:
    در این مطالعه توصیفی- مقطعی، از 40 بیمار تازه تشخیص داده شده B-ALL و هم چنین از 15 فرد سالم به عنوان گروه کنترل، یک میلی‌لیتر مغز استخوان همراه با ضد انعقاد K2-EDTA از آزمایشگاه تشخیص طبی و تخصصی پیوند در سال‌های 1394 و 1395 جمع‌آوری شد. کل بیماران 17 زن و 23 مرد بودند که میانگین سنی آن‌ها 4 سال و تشخیص آن‌ها Common B ALL بود. گروه کنترل هم از کودکان سالم انتخاب شد. معیارهای انتخاب بیماران بر اساس یافته‌های مورفولوژیکی خون شناسی خاص لوسمی لنفوبلاستیک حاد(از جمله افزایش تعداد گلبول‌های سفید، افزایش رده لنفوئیدی مانند لنفوبلاست خون محیطی)، آزمایش‌های مولکولی ]از جمله [t(12;21) و ایمنوفنوتایپینگ به روش فلوسایتومتری(بررسی CD مارکرهای رده لنفوئیدی) بود. تمامی بیماران تازه تشخیص داده شده بودند و هیچ گونه دارویی مصرف نکرده بودند. معیار انتخاب افراد کنترل هم نداشتن هیچ‌گونه بیماری از جمله بدخیمی‌های خونی و دیگر بدخیمی‌ها بود. کلیه نمونه‌ها با گرفتن رضایت‌نامه به منظور انجام کارهای تحقیقاتی جمع‌آوری شدند. نمونه‌های مغز استخوان در دمای 4 درجه سانتی‌گراد نگهداری و از هر یک از نمونه‌ها (بیماران و کنترل) RNA استخراج گردید.
 
استخراج RNA :
مراحل کار به شرح زیر می‌باشد:
    یک میلی‌لیتر RNX-Plus سرد به 500 میکرولیتر نمونه مغز استخوان اضافه و خوب مخلوط شد. سپس سوسپانسیون وارد یک میکروتیوب 5/1 میلی‌لیتری گردید و به مدت 1 دقیقه ورتکس شد. بعد از ورتکس، این مخلوط 5 دقیقه در دمای اتاق گذاشته شد. 200 میکرولیتر کلروفرم(به منظور جداسازی اجزای سلولی برحسب چگالی) به محتویات میکروتیوب اضافه کرده و یک دقیقه به شدت تکان داده شد. سپس 5 دقیقه در دمای 4 درجه سانتی‌گراد قرار داده شد. سانتریفوژ 4 درجه سانتی‌گراد، 20 دقیقه در rpm 12000 انجام شد. جداسازی محلول رویی (فاز آبی) و انتقال آن به میکروتیوب جدید صورت گرفت. هم حجم فاز آبی(محلول رویی) به آن اتانول 100% سرد (به منظور آبگیری) اضافه گردید. سپس به آرامی مخلوط کرده به مدت20 دقیقه در دمای 20- درجه سانتی‌گراد قرار داده شد. سانتریفوژ 4 درجه سانتی‌گراد، 15 دقیقه در  rpm 12000و دور ریختن محلول رویی (رسوب سفیدرنگی دیده می شود) انجام شد. یک میلی لیتر اتانول 70% سرد اضافه و ورتکس شد تا رسوب از ته لوله کنده شود. سانتریفوژ 4 درجه سانتی گراد، 15 دقیقه در  rpm 12000 صورت گرفت. محلول رویی دور ریخته شد و درب لوله 10 دقیقه باز ماند تاRNA  رسوب کرده خشک شود. حدود50-30 میکرولیتر آبRNase-DNase free  اضافه شد و در ادامه کیفیت و غلظت RNA استخراج شده با روش فتومتری تعیین گردید. نهایتاً محلول حاصل، جهت نگهداری به فریزر 70- درجه سانتی گراد منتقل شد.
 
ساختcDNA :
    مراحل ساخت cDNA به شرح زیر انجام شد:
یک میکروگرم از RNA تخلیص شده در لوله 200 میکرولیتر جداگانه، با 5/1 میکرولیتر از آغازگر 10پیکومول Random Hexamer مخلوط و حجم تیوب با آب RNase-DNase free به حجم 13 میکرولیتر رسانده شد. درب لوله‌ها را بسته و به مدت 10 دقیقه در دمای 70 درجه سانتی‌گراد در ترموسایکلر گذاشته شد. سپس لوله‌ها فوراً بر روی یخ قرار گرفت و به هر کدام از آن‌ها، 4 میکرولیتر بافر X 5 (فرمنتاز)، 2 میکرولیتر dNTP (mm 10) و 1 میکرولیتر ترانس‌کریپتاز معکوس(فرمنتاز) افزوده شد. سپس درب لوله را بسته و طبق دستورالعمل دمایی در ترموسایکلر گذاشته شد. دستورالعمل دمایی به این صورت بود: دمای 25 درجه سانتی‌گراد به مدت 10 دقیقه، دمای 37 درجه سانتی‌گراد 10 دقیقه، دمای 42 درجه سانتی‌گراد 45 دقیقه و در نهایت 75 درجه سانتی‌گراد (برای غیر فعال کردن آنزیم) 10 دقیقه.
 
واکنش Real-Time PCR برای بررسی میزان بیان HOTAIR:
    سنجش میزان بیان HOTAIR به روش Real Time PCR (دستگاه ABI) صورت گرفت. در این مرحله جهت بررسی میزان بیان HOTAIR در نمونه‌های Common B-ALL و نمونه‌های کنترل، نیاز به آغازگرهای جلوبرنده و معکوس برای ژن HOTAIR است. از ژن B2M به عنوان کنترل داخلی برای طبیعی کردن نتایج استفاده شد.
 
جدول 1: اجزای لازم برای واکنش Real-time PCR در دستگاه ABI
 
اجزای تشکیل دهنده غلظت(µM)
Master Mix(SYBRR Premix Ex TaqTM- Takara) (5/12) × μL 1
Forward Primer (10pmol) 5/0
Reverse Primer (10pmol) 5/0
Template (cDNA) μL 2
diH2O تا حجم μL 25
 
جدول 2: برنامه زمانی مراحل واکنش Real-time PCR برای LncRNA ها
 
مرحله دما
(درجه سانتی گراد)
زمان
(ثانیه)
چرخه
فعال‌سازی آنزیم 95 30 1
دناچوراسیون 95 5 45
آنیلینگ و اکستنشن 60 30
افزایش دما از 50 درجه سانتی‌گراد تا Melt برای رسم منحنی 90 درجه سانتی‌گراد
 

جدول 3: توالی آغازگرهای طراحی شده برای ردیابی HOTAIR و b2M
 
نام ژن آغازگر طول محصول (bp)
HOTAIR F: GAAAGCTTCCACAGTGAGGACT
R: AAATCCGTTCCATTCCACTG
123
B2M F: ATGCCTGCCGTGTGAAC
R:  ATCTTCAAACCTCCATGATG
91
 
    نمونه کنترل منفی با عنوان NTC (No template Control) نیز که شامل تمامی مواد به غیر از cDNA می‌باشد، در هرسری کاری گذاشته شد. نمونه‌ها را به آرامی و بدون ورتکس مخلوط کرده و در دستگاه Real time PCR (ABI) PCR شد(جداول 1 و 2).
 
دمای ذوب

روش‌های آماری:
    میزان بیان HOTAIR و β2M (کنترل داخلی) در نمونه‌های مغز استخوان بیماران مبتلا به B-ALL و افراد سالم به دست آمد و نتایج در برنامه 2009 REST (Relative Expression Software Tool)(کیاژن، آلمان) به صورت سنجش نسبی با روش 2-ΔΔCT با راندمان (efficiency) یک، تجزیه و تحلیل شد(جدول 3).
 
یافته‌ها
نتیجه Real-Time PCR :
    با آنالیز و مقایسه نتایج Real-Time PCR ، بیان سطح HOTAIR در بیماران نسبت به افراد سالم مشخص شد. میزان بیان آن به طور معناداری 121 برابر بیشتر بود(نمودارهای 1 و 2)(05/0 p<).
 
 


 
 نمودار 1: نمودارهای ذوب و تکثیر HOTAIR به روش Real Time PCR
 
Text Box: تغییر بیان(Fold Change)

 
 
 
 
 
 
 
 
 
 
 

نمودار 2: بیان سطح mRNA ژن HOTAIR در بیماران مبتلا به لوسمی لنفوبلاستیک حاد نوع B در مقایسه با نمونه‌های افراد سالم(05/0 p<)  

بحث
    در مطالعه‌های مختلف، مشخص شده است که یکی از تنظیم‌گرهای مهم روند خونسازی در سطح mRNA ، یک کلاس از RNAهای غیر کدکننده به نام LncRNA ها می‌باشند(15). بنابراین بسیار حائز اهمیت است که مشخص گردد چطور LncRNA ها در تنظیم یا از تنظیم خارج شدن روند خونسازی نقش ایفا می‌کنند. در مطالعه حاضر، هدف بررسی بیان سطح HOTAIR در بیماران تازه تشخیص داده شده لوسمی لنفوبلاستیک حاد نوع B با روش Real-Time PCR بود که به این منظور میزان بیان HOTAIR در نمونه‌های مغز استخوان بیماران تازه تشخیص داده شده B-ALL و افراد سالم به عنوان گروه کنترل سنجیده شد. نتایج نشان داد که میزان بیان در بیمـاران نسبت به افراد سالـم افزایـش معنـاداری دارد (05/0 p). HOTAIR یک LncRNA می‌باشد که نقش یک انکوژن را در سرطان‌های مختلف از جمله سینه، معده، روده و رحم دارد(18-16). می‌توان نقش آن را در این لوسمی به عنوان انکوژن به طور بالقوه در نظر داشت. از طرفی مطالعه‌های گسترده‌ای نقش کلیدی HOTAIR را به عنوان عامل شروع‌کننده و پیشرفت‌دهنده در سرطان‌های مختلف نشان داده‌اند(19).
     با توجه به این که مطالعه حاضر در بیماران تازه تشخیص داده شده انجام شد، می‌توان آن را یکی از عوامل بالقوه شروع‌کننده این لوسمی دانست. در مطالعه ژانگ که تغییرات بیان HOTAIR در برخی از لوسمی‌های حاد بررسی شده است، بیان HOTAIR در بیماران لوسمی منوبلاستیک حاد افزایش معناداری داشته و نشان داده شد در مقایسه با افرادی که میزان بیانHOTAIR کمتری داشتند، میزان بقا کمتر است(20).
    در مطالعه هائو مشخص شده که میزان بیان HOTAIR در لوسمی میلوبلاستیک حاد افزایش دارد و نشان‌دهنده پیش‌آگهی ضعیف در بیماران می‌باشد(21). در واقع یک trans-acting LncRNA است که با Polycomb Repressive Complex 2 (PRC2) برهمکنش دارد و نقش مهمی در اشغال جایگاه آن به طور فیزیکی ایفا می‌کند(22). PRC2 یک هیستون متیل ترنسفراز است که خاموش‌سازی اپی‌ژنتیکی بسیاری از ژن‌ها را در مسیرهای مختلف از جمله در به وجود آمدن بدخیمی یا سرطان کنترل می‌کند. این بدین معنی است که در حالت عادی، PRC2 بدون برهمکنش باعث جلوگیری از بدخیمی‌ها می‌شود، در حالی که وقتی HOTAIR با PRC2 برهمکنش برقرار می‌کند، مسیرهای منتهی به بدخیمی فعال می‌شوند و این گونه استنتاج می‌شود که افزایش بیان HOTAIR می‌تواند یکی از دلایل کمک‌کننده به ایجاد بدخیمی ALL باشد(23). در مطالعه لوون و همکاران مشخص شد که میزان بیان HOTAIR در بیماران مبتلا به سرطان ریه افزایش معناداری در مقایسه با گروه کنترل دارد و از طرفی سطح افزایش آن نیز با متاستاز و پیش‌آگهی فقیر همراه می‌باشد(24).
    وو و همکاران میزان افزایش یافته بیان ژن HOTAIR را در سلول‌های کارسینومایی کلیه گزارش کردند(25). در مطالعه یان وهمکاران مشخص شد که بیان ژن HOTAIR در نمونه‌های بافتی سرطان مثانه افزایش دارد(26). تغییرات میزان بیان HOTAIR در این بیماری به طور بالقوه نشان‌دهنده نقش آن در پاتوژنز بیماری می‌باشد بنابراین می‌توانـد بـه عنـوان یـک هدف درمانی در نظر گرفته شود.
    HOTAIR در آینده می‌تواند به عنوان یک هدف درمانی جهت بهبود روش‌های درمانی موجود برای بدخیمی‌های خونی از جمله لوسمی لنفوبلاستیک حاد قرار گیرد. اگر چه برای رسیدن به اهداف درمانی نیاز به مشخص شدن دقیق مسیرهای مولکولی تغییردهنده بیان این ژن می‌باشد.
 
نتیجه‌گیری
    با توجه به داده‌های کسب شده، می‌توان نتیجه گرفت که میزان بیان HOTAIR در لوسمی لنفوبلاستیک حاد نوع B بیان افزایشی دارد و می‌تواند پیشگوکننده این باشد که افزایش بیان آن با پاتوفیزیولوژی این بیماری در ارتباط می‌باشد. هم چنین به مطالعه‌های بیشتری نیاز است تا با بررسی LncRNA های مهم دیگر و مشخص کردن ژن‌های هدف آن‌ها، بتوان نقش دقیق آن‌ها را در پاتوژنز این بیماری و ارتباط بیان آن‌ها با میزان بقای بیماران تعیین کرد و در ادامه از آن‌ها در درمان استفاده نمود.
تشکر و قدردانی
    این پژوهش در قالب طرح تحقیقاتی و با مساعدت‌های مالی دانشگاه علوم پزشکی البرز در مرکز تحقیقات فن‌آوری بن یاخته با کد اخلاق 102/1394 انجام شده
است که بدین وسیله از آن‌ها قدردانی می‌شود. هم چنین از آزمایشگاه تشخیص طبی و تخصصی پیوند به خاطر کمک در جمع‌آوری نمونه‌ها تشکر می‌شود.
ارسال پیام به نویسنده مسئول

ارسال نظر درباره این مقاله
نام کاربری یا پست الکترونیک شما:

کد امنیتی را در کادر بنویسید >


XML   English Abstract   Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Fallah P, Molaie M, Ehsan Heidari A, Soleimani M, Jahedi Zargar M, Arefian E, et al . HOTAIR expression in newly diagnosed Acute Lymphoblastic Leukemia pateints. Sci J Iran Blood Transfus Organ. 2019; 15 (1) :28-35
URL: http://bloodjournal.ir/article-1-1139-fa.html

فلاح پرویز، ملایی مجتبی، احسان حیدری علی، سلیمانی مسعود، جاهدی برزگر مهدی، عارفیان احسان، و همکاران.. بیان LncRNA HOX transcript antisense RNA در بیماران تازه تشخیص داده شده لوسمی لنفوبلاستیک حاد . فصلنامه پژوهشی خون . 1397; 15 (1) :28-35

URL: http://bloodjournal.ir/article-1-1139-fa.html



جلد 15، شماره 1 - ( بهار 1397 ) برگشت به فهرست نسخه ها
فصلنامه پژوهشی خون Scientific Journal of Iran Blood Transfus Organ
The Scientific Journal of Iranian Blood Transfusion Organization - Copyright 2006 by IBTO
Persian site map - English site map - Created in 0.08 seconds with 32 queries by YEKTAWEB 3708